SGN Marker TG432

SGN-M245

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGGAGACATCTTGCATGCCTGCAGAGATGGATGAGTTAGATCCACCGTTAAGAAATCTTTTTAAAGAGAAATATAAAGATGGAGTGCACA
GCTAGTCAACTAACCGAAAAGAAAGCAGTTGGATCTTCATCATCTCCATCTGTATCTGTCATTGGTAATGCATGGCGCAATAGTAGAAGA
GCCATCAACTGTCAATGAAAATTATCATTTAACACTGGACATCCAATAATCCATAAAGGAGAGACAAGTCAAGATAGATCAGCACCAACT
GAGAGGCCAATCTTTATATAAAGGTTGAACAAACGACTACACTTTGCATTTTGA
Reverse sequence
TACACACACCGAGCATGCGTTCAACACTGGTGCAATGAGAAGGGGGATATTACTTGTGAGATTTGCCATCAGGTATGTGTCAATCTTCCA
GTTGGTTTCCAACTTCCCATATTGTCTTGTATATTATAAGATGAAAGACACTGCATTCTATGCGAGAGTACTCCTGCTTGTGCCATTGAG
TTCAAACCACAGGGTTCTCTTCCCTCTTGAATAGGAGTGGGGTTTTTAACCTGTCGGCACCCCAAGGGTATTGTCTATGGGTTTCCCTTG
TCATTAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1591982.3e-0877 (23.8% of RFLP seq)+
SGN-U1525848.6e-3984 (25.9% of RFLP seq)+
SGN-U1559245.1e-0954 (19.2% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53318)
Chromosome
5
Position
20.68 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40042)
Chromosome
5
Position
21.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8721)
Chromosome
5
Position
13.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG432 was used as an overgo probe on plate 5 [well E3]

Plausible BAC Matches:   P153M18,   P165L04,   P282E24,   P145P19

 Overgo Sequences

A sequence
ATCTTGCATGCCTGCAGAGATGGA
B sequence
CGGTGGATCTAACTCATCCATCTC
AB sequence
ATCTTGCATGCCTGCAGAGATGGATGAGTT
Marker sequence
GGGAGACATCTTGCATGCCTGCAGAGATGGATGAGTTAGATCCACCGTTA
AGAAATCTTTTTAAAGAGAAATATAAAGATGGAGTGCACAGCTAGTCAAC
TAACCGAAAAGAAAGCAGTTGGATCTTCATCATCTCCATCTGTATCTGTC
ATTGGTAATGCATGGCGCAATAGTAGAAGAGCCATCAACTGTCAATGAAA
ATTATCATTTAACACTGGACATCCAATAATCCATAAAGGAGAGACAAGTC
AAGATAGATCAGCACCAACTGAGAGGCCAATCTTTATATAAAGGTTGAAC
AAACGACTACACTTTGCATTTTGA
Genomic location of TG432  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D245 marker 245
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)