SGN Marker solcap_snp_sl_54371

SGN-M24508

Synonyms  
SGN-U582606_snp195
SGN-U582606_snp195_solcap_snp_sl_54371
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60839)
Chromosome
6
Position
44.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACATTAAGAGCAGAGATAATAGAAGGGGGAATTTCAACGGGTGAGGTTTC
  
3' flanking region
TCTGTGTCTATCGCTGAGGCTGTGTCGCTGCTACTGGAGTTTCCAACTAT
SNP nucleotide
AG
SNPdb format
ACATTAAGAGCAGAGATAATAGAAGGGGGAATTTCAACGGGTGAGGTTTC[A/G]
TCTGTGTCTATCGCTGAGGCTGTGTCGCTGCTACTGGAGTTTCCAACTAT
  
Genomic location of solcap_snp_sl_54371  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24508 marker 24508
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)