SGN Marker solcap_snp_sl_54417

SGN-M24509

Synonyms  
SGN-U578566_snp704
SGN-U578566_snp704_solcap_snp_sl_54417
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70443)
Chromosome
6
Position
64.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66976)
Chromosome
6
Position
80.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63452)
Chromosome
6
Position
97.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60840)
Chromosome
6
Position
44.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GACACTTTCAATTTCAATTACTTCATTTTGCTTTCACTCCTAGATGCAAT
  
3' flanking region
TCTTCATTGTGCTTTGGATGAAAGAACAAAATGTTGGTAAGGAAATCAGT
SNP nucleotide
AG
SNPdb format
GACACTTTCAATTTCAATTACTTCATTTTGCTTTCACTCCTAGATGCAAT[A/G]
TCTTCATTGTGCTTTGGATGAAAGAACAAAATGTTGGTAAGGAAATCAGT
  
Genomic location of solcap_snp_sl_54417  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24509 marker 24509
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)