SGN Marker solcap_snp_sl_54547

SGN-M24515

Synonyms  
3284_1_60
3284_1_60_solcap_snp_sl_54547
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70074)
Chromosome
1
Position
112.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66390)
Chromosome
1
Position
101.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62889)
Chromosome
1
Position
176.01 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60846)
Chromosome
1
Position
86.12 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTTAACAGACAAACATTTCATTTATAATATTTACCAGACAATCAGAAAA
  
3' flanking region
GTATTACTGAATTTGAAACTCAATTCTAATTCCTGATGAAGGAAATTCCT
SNP nucleotide
AG
SNPdb format
ACTTAACAGACAAACATTTCATTTATAATATTTACCAGACAATCAGAAAA[A/G]
GTATTACTGAATTTGAAACTCAATTCTAATTCCTGATGAAGGAAATTCCT
  
Genomic location of solcap_snp_sl_54547  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24515 marker 24515
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)