SGN Marker solcap_snp_sl_54631

SGN-M24521

Synonyms  
CL015970-0397
CL015970-0397_solcap_snp_sl_54631
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60852)
Chromosome
1
Position
86.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCTCAAAAGTAGTTTCTTCGTTGTGATCGAGACGACGACAACGTATCAC
  
3' flanking region
GATCGCCAAACGTGAGCCAACACAGCTTGAAGAGAAGAAATCTTTGTGGT
SNP nucleotide
AG
SNPdb format
ACCTCAAAAGTAGTTTCTTCGTTGTGATCGAGACGACGACAACGTATCAC[A/G]
GATCGCCAAACGTGAGCCAACACAGCTTGAAGAGAAGAAATCTTTGTGGT
  
Genomic location of solcap_snp_sl_54631  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24521 marker 24521
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)