Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_54685

SGN-M24523

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73563)
Chromosome
1
Position
115.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69354)
Chromosome
1
Position
104.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65699)
Chromosome
1
Position
186.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60854)
Chromosome
1
Position
86.76 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGATTTAGTCGAAAACTTCCTGGCCATCTCAAGTCAAATCCTTCATCCAC
  
3' flanking region
GGATTGGGATGAGATGTCATTTGAAAGCCTGTACTAGCATCGCTGAACCT
SNP nucleotide
TC
SNPdb format
GGATTTAGTCGAAAACTTCCTGGCCATCTCAAGTCAAATCCTTCATCCAC[T/C]
GGATTGGGATGAGATGTCATTTGAAAGCCTGTACTAGCATCGCTGAACCT
  
Genomic location of solcap_snp_sl_54685  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24523 marker 24523
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)