SGN Marker solcap_snp_sl_55282

SGN-M24567

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73595)
Chromosome
7
Position
33.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60898)
Chromosome
7
Position
26.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCCTGATAATGATGGTATAGCAAATGCACGAGAAAGGGCCCCAACTACT
  
3' flanking region
AAAAGTTCTTTCTCTGGTCAATTACAAACAAATTTGCCTTTGCTGATGCT
SNP nucleotide
TG
SNPdb format
GCCCTGATAATGATGGTATAGCAAATGCACGAGAAAGGGCCCCAACTACT[T/G]
AAAAGTTCTTTCTCTGGTCAATTACAAACAAATTTGCCTTTGCTGATGCT
  
Genomic location of solcap_snp_sl_55282  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24567 marker 24567
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)