SGN Marker solcap_snp_sl_55433

SGN-M24593

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60924)
Chromosome
7
Position
61.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTACCTACACCTCTTGCAACATTAGCCATGTTTATGTGGCTACCAATTGG
  
3' flanking region
ATTCCACTAGCTATTTTTAGAATCTTAATTGGCATATGTTTGCCATACAA
SNP nucleotide
AG
SNPdb format
TTACCTACACCTCTTGCAACATTAGCCATGTTTATGTGGCTACCAATTGG[A/G]
ATTCCACTAGCTATTTTTAGAATCTTAATTGGCATATGTTTGCCATACAA
  
Genomic location of solcap_snp_sl_55433  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24593 marker 24593
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)