Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_55435

SGN-M24594

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73617)
Chromosome
5
Position
88.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69386)
Chromosome
5
Position
93.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65728)
Chromosome
5
Position
149.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60925)
Chromosome
7
Position
61.48 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTATCACGAGATGAATAAAAATGTGATGGTAATAATTCAGGATGATATTT
  
3' flanking region
GTGAGACAGCTGCTGAAGTAGTAGGCGTAATTGGCCCAGCGCCAAATACT
SNP nucleotide
AG
SNPdb format
GTATCACGAGATGAATAAAAATGTGATGGTAATAATTCAGGATGATATTT[A/G]
GTGAGACAGCTGCTGAAGTAGTAGGCGTAATTGGCCCAGCGCCAAATACT
  
Genomic location of solcap_snp_sl_55435  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24594 marker 24594
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)