SGN Marker TG506

SGN-M246

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG506 image not available
Forward sequence
AAATGCTTCGCCTGTGACCTGTCCTAAAGATAAATGTTCATAAAGAAAAGGGAACTTTTGAAATGAATCTATTTATGTAGAATTATTCAA
CTTAAGTACTTCCCTTTTCAAATTTGACATGTCTGTTTTTATTTCCATTCACATTAAGCTTGCTTACTGAATATATAGAGGGTTCATATA
TTTGACTCGGGTTGATCTTGATTTGAGGCATAGTTGATTGATTGAGAAAAATTACTTGCACTAACAATAAGTATTCTTCTGTTTGCTTTC
TGTATTTACTTTCTATTACAGTGAGGAAAACATCTACCTGCTATGCAAAAAGCTATGTGATGACGGACTGGCAGATCCTAATGGTTCTGA
TCTGTTTGTTATTTTCATTTCCAATGAGAAGAAGCAGGCAACTACTCTTTGCTCTTCCTTTGGTTACTGTCTTAAGAAGTTCATTCATTG
CATTGATACTT
Reverse sequence
GGAGACAGCTTGCATGCCAGCAGTCCAGTTTCCAGCAGAATCCTTCATATGTCTTCTATCTGATGCGAAGTGTCGGAGGAATATAGGGGC
ATGCACAACTCGAAAAAACCTGAAATGGCCAAAGTTGTTCTTTCATGTGGTTGCAGTAAGCTTATTATTCCAAGCACAAGGTTGGCAACA
TTGCTTAGCACCAGAAGAAAAACACACTCTGGTTTCTTCTTCAGAAAAAGGTCAGTGAAAGAGCATTTCTTTAATGAGACCACCCCTTTA
GGGTGGACTTGTGAAATCAATTTTTAAAGATAAACAAAAAATGAGATTCACTAGGTAGAGCATAAATTTTACGAAAAGTTAGAAACATTT
TAAGGTTGGGTTGACTTCAGGAAGGAATGGAGAAAAACAATACACAGAAGAGCAATAGAACTACTTTTGTATCACTATATCAAGAATCTT
ATAATTTGAGCAAAAATGAAATATCTAGCTTCTATAAAAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1543239.6e-55107 (23.2% of RFLP seq)+
SGN-U1543239.1e-4692 (18.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8724)
Chromosome
4
Position
42.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG506 was used as an overgo probe on plate 9 [well F9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P262J21,   P182M24,   P268A10,   P072J15,   P062J03,   P206I23,   P209A01,   P123C09,   P116I09,   P114C15,   P025H22

 Overgo Sequences

A sequence
CTATGTGATGACGGACTGGCAGAT
B sequence
GATCAGAACCATTAGGATCTGCCA
AB sequence
CTATGTGATGACGGACTGGCAGATCCTAAT
Marker sequence
AAATGCTTCGCCTGTGACCTGTCCTAAAGATAAATGTTCATAAAGAAAAG
GGAACTTTTGAAATGAATCTATTTATGTAGAATTATTCAACTTAAGTACT
TCCCTTTTCAAATTTGACATGTCTGTTTTTATTTCCATTCACATTAAGCT
TGCTTACTGAATATATAGAGGGTTCATATATTTGACTCGGGTTGATCTTG
ATTTGAGGCATAGTTGATTGATTGAGAAAAATTACTTGCACTAACAATAA
GTATTCTTCTGTTTGCTTTCTGTATTTACTTTCTATTACAGTGAGGAAAA
CATCTACCTGCTATGCAAAAAGCTATGTGATGACGGACTGGCAGATCCTA
ATGGTTCTGATCTGTTTGTTATTTTCATTTCCAATGAGAAGAAGCAGGCA
ACTACTCTTTGCTCTTCCTTTGGTTACTGTCTTAAGAAGTTCATTCATTG
CATTGATACTT
Genomic location of TG506  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D246 marker 246
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)