Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_55475

SGN-M24600

Synonyms  
CL017588-0132
CL017588-0132_solcap_snp_sl_55475
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60931)
Chromosome
7
Position
61.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAGAAAATCAAAGTGTTGTTGTTTTACTCTCAGTTCTACACATAGTTGC
  
3' flanking region
GCAAAGACCAAGAAAAACCCCAAAACAATAGCTACAGTATCGACCCAGAT
SNP nucleotide
AT
SNPdb format
TCAGAAAATCAAAGTGTTGTTGTTTTACTCTCAGTTCTACACATAGTTGC[A/T]
GCAAAGACCAAGAAAAACCCCAAAACAATAGCTACAGTATCGACCCAGAT
  
Genomic location of solcap_snp_sl_55475  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24600 marker 24600
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)