SGN Marker solcap_snp_sl_56003

SGN-M24634

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60965)
Chromosome
6
Position
35.31 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACATGACCAAGATAAAGCATCTACATAGACTCCACCAGAAGTAAAAGTT
  
3' flanking region
ATTTTGTAGAGTTATGAAATTGTTCTTGATATTGAAACTATACGAACTCA
SNP nucleotide
AG
SNPdb format
AACATGACCAAGATAAAGCATCTACATAGACTCCACCAGAAGTAAAAGTT[A/G]
ATTTTGTAGAGTTATGAAATTGTTCTTGATATTGAAACTATACGAACTCA
  
Genomic location of solcap_snp_sl_56003  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24634 marker 24634
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)