SGN Marker solcap_snp_sl_56094

SGN-M24644

Synonyms  
SL1_00sc6004_1613844
SL1_00sc6004_1613844_solcap_snp_sl_56094
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70575)
Chromosome
11
Position
81.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60975)
Chromosome
11
Position
51.79 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GACGATATAGTGAAGACGAAGAAACGAAATCATATGTTGGGGGTTTCAAT
  
3' flanking region
GTGGCTGTCAACGGAGAAAAGCAAGAAAGAAGGCCGCGTTTCGTTGTCTT
SNP nucleotide
AG
SNPdb format
GACGATATAGTGAAGACGAAGAAACGAAATCATATGTTGGGGGTTTCAAT[A/G]
GTGGCTGTCAACGGAGAAAAGCAAGAAAGAAGGCCGCGTTTCGTTGTCTT
  
Genomic location of solcap_snp_sl_56094  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24644 marker 24644
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)