SGN Marker solcap_snp_sl_56102

SGN-M24646

Synonyms  
SL1_00sc6004_1545818
SL1_00sc6004_1545818_solcap_snp_sl_56102
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70570)
Chromosome
11
Position
80.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60977)
Chromosome
11
Position
51.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTTTCGGAAACAGTCTCTCTACCTCCACTTGGTAGTAGAAAGGTTTGTG
  
3' flanking region
AAACTCTACCCTCCCCAAACCCCGCTTGGTGGGATTTCACGGGAGGGATG
SNP nucleotide
TC
SNPdb format
TCTTTCGGAAACAGTCTCTCTACCTCCACTTGGTAGTAGAAAGGTTTGTG[T/C]
AAACTCTACCCTCCCCAAACCCCGCTTGGTGGGATTTCACGGGAGGGATG
  
Genomic location of solcap_snp_sl_56102  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24646 marker 24646
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)