SGN Marker solcap_snp_sl_56104

SGN-M24648

Synonyms  
SL1_00sc6004_1545612
SL1_00sc6004_1545612_solcap_snp_sl_56104
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70568)
Chromosome
11
Position
80.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67066)
Chromosome
11
Position
83.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63532)
Chromosome
11
Position
97.29 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60979)
Chromosome
11
Position
51.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGCCACATTCACAATCCAGTAAGAACTACCTATAGCTGAAAGAAATCTGA
  
3' flanking region
TCAATACTGTTTTCTCTCTTCCTGTATGGACTGAAAAATCCGAGCAACAG
SNP nucleotide
CG
SNPdb format
GGCCACATTCACAATCCAGTAAGAACTACCTATAGCTGAAAGAAATCTGA[C/G]
TCAATACTGTTTTCTCTCTTCCTGTATGGACTGAAAAATCCGAGCAACAG
  
Genomic location of solcap_snp_sl_56104  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24648 marker 24648
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)