Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_56170

SGN-M24663

Synonyms  
SL1_00sc6004_1041347
SL1_00sc6004_1041347_solcap_snp_sl_56170
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70554)
Chromosome
11
Position
75.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67057)
Chromosome
11
Position
80.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63523)
Chromosome
11
Position
94.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60994)
Chromosome
11
Position
51.21 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTAGTGAAGCTTTGCCAGAACCAACCATTGCTGCTGACCCTGCGATGTC
  
3' flanking region
CCCGCGCCAGAGTTTGTTCCTATGAGTAGTTATTTGTTTGATGTATACTG
SNP nucleotide
AG
SNPdb format
AGTAGTGAAGCTTTGCCAGAACCAACCATTGCTGCTGACCCTGCGATGTC[A/G]
CCCGCGCCAGAGTTTGTTCCTATGAGTAGTTATTTGTTTGATGTATACTG
  
Genomic location of solcap_snp_sl_56170  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24663 marker 24663
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)