SGN Marker solcap_snp_sl_56173

SGN-M24665

Synonyms  
SL1_00sc6004_1025119
SL1_00sc6004_1025119_solcap_snp_sl_56173
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70553)
Chromosome
11
Position
75.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67056)
Chromosome
11
Position
80.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 60996)
Chromosome
11
Position
51.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGAGGATTCAATGGTGCTCAGGAATGAGGTTCAAAATGGCTTTTGAAAC
  
3' flanking region
GAGGATTCTTCTCGAATCAGTTGGTTCATGGGAACTATATCCTCCATTCA
SNP nucleotide
TC
SNPdb format
ATGAGGATTCAATGGTGCTCAGGAATGAGGTTCAAAATGGCTTTTGAAAC[T/C]
GAGGATTCTTCTCGAATCAGTTGGTTCATGGGAACTATATCCTCCATTCA
  
Genomic location of solcap_snp_sl_56173  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24665 marker 24665
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)