SGN Marker solcap_snp_sl_56231

SGN-M24671

Synonyms  
SL1_00sc6004_880319
SL1_00sc6004_880319_solcap_snp_sl_56231
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70634)
Chromosome
11
Position
74.25 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67110)
Chromosome
11
Position
78.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63576)
Chromosome
11
Position
93.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61002)
Chromosome
11
Position
51.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTGAAATTGGTGTAACGGGCAAAGACGAGGTCCTCTTGATGCGAGGCGT
  
3' flanking region
AACATTTTAGTAAGTGACCATGACCTTGAAATGGATACCTTCTCTTGTTG
SNP nucleotide
AG
SNPdb format
TGTGAAATTGGTGTAACGGGCAAAGACGAGGTCCTCTTGATGCGAGGCGT[A/G]
AACATTTTAGTAAGTGACCATGACCTTGAAATGGATACCTTCTCTTGTTG
  
Genomic location of solcap_snp_sl_56231  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24671 marker 24671
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)