SGN Marker solcap_snp_sl_56235

SGN-M24673

Synonyms  
SL1_00sc6004_860168
SL1_00sc6004_860168_solcap_snp_sl_56235
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61004)
Chromosome
11
Position
51.02 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAACTGAAGGTGCTCCGATGAGTCATCTCCATTCAATTCCGATTTCACGA
  
3' flanking region
TACCGGCGAATGGAGCTTCTCCGATGACTCCTCGCCGTTCAATTCAGGGT
SNP nucleotide
AT
SNPdb format
CAACTGAAGGTGCTCCGATGAGTCATCTCCATTCAATTCCGATTTCACGA[A/T]
TACCGGCGAATGGAGCTTCTCCGATGACTCCTCGCCGTTCAATTCAGGGT
  
Genomic location of solcap_snp_sl_56235  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24673 marker 24673
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)