SGN Marker solcap_snp_sl_56295

SGN-M24681

Synonyms  
SL1_00sc6004_547009
SL1_00sc6004_547009_solcap_snp_sl_56295
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70631)
Chromosome
11
Position
71.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67107)
Chromosome
11
Position
77.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63573)
Chromosome
11
Position
93.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61012)
Chromosome
11
Position
50.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTAACACAACACCTTTACTAACCCCCGTTGTACCCGAAGAATACAACA
  
3' flanking region
TACAGCAGTATCAGTTTGTTTCACCACAGTTTTATCCAAATCAAAACACC
SNP nucleotide
AG
SNPdb format
AGTTAACACAACACCTTTACTAACCCCCGTTGTACCCGAAGAATACAACA[A/G]
TACAGCAGTATCAGTTTGTTTCACCACAGTTTTATCCAAATCAAAACACC
  
Genomic location of solcap_snp_sl_56295  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24681 marker 24681
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)