SGN Marker solcap_snp_sl_56303

SGN-M24685

Synonyms  
SL1_00sc6004_502012
SL1_00sc6004_502012_solcap_snp_sl_56303
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70627)
Chromosome
11
Position
71.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67105)
Chromosome
11
Position
76.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63571)
Chromosome
11
Position
92.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61016)
Chromosome
11
Position
50.67 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCGTAAAAGGAATAGTTAACTACATCCAACACACGAAGCAATTTGAACCC
  
3' flanking region
ATACAACCAAAGTAGGAATCCTCTAAAACGGAGCATGCTTTTGATGACAG
SNP nucleotide
AC
SNPdb format
CCGTAAAAGGAATAGTTAACTACATCCAACACACGAAGCAATTTGAACCC[A/C]
ATACAACCAAAGTAGGAATCCTCTAAAACGGAGCATGCTTTTGATGACAG
  
Genomic location of solcap_snp_sl_56303  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24685 marker 24685
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)