SGN Marker solcap_snp_sl_56324

SGN-M24687

Synonyms  
SL1_00sc6004_392552
SL1_00sc6004_392552_solcap_snp_sl_56324
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70621)
Chromosome
11
Position
68.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67100)
Chromosome
11
Position
72.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63566)
Chromosome
11
Position
89.13 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61018)
Chromosome
11
Position
50.56 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CACGAAAATGAGCAGATTGTCAGGGAGATTCCAATTGAGGAGATCAATGG
  
3' flanking region
ACAGAATCCGCTGCAGCATGTGTTAACAATTCTGTGCAGCAAGAAGCCAC
SNP nucleotide
TC
SNPdb format
CACGAAAATGAGCAGATTGTCAGGGAGATTCCAATTGAGGAGATCAATGG[T/C]
ACAGAATCCGCTGCAGCATGTGTTAACAATTCTGTGCAGCAAGAAGCCAC
  
Genomic location of solcap_snp_sl_56324  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24687 marker 24687
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)