SGN Marker solcap_snp_sl_56524

SGN-M24699

Synonyms  
CL017542-0161
CL017542-0161_solcap_snp_sl_56524
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61030)
Chromosome
8
Position
0.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCCGGCGATTGGCGGCTTCCCGGAGGAAACAGGCGGACGAGGAGGTAAA
  
3' flanking region
TCATCGACGAAAACACTTTACCATTCGAAACACTTCCTTCACCTGTAATC
SNP nucleotide
TC
SNPdb format
TCCCGGCGATTGGCGGCTTCCCGGAGGAAACAGGCGGACGAGGAGGTAAA[T/C]
TCATCGACGAAAACACTTTACCATTCGAAACACTTCCTTCACCTGTAATC
  
Genomic location of solcap_snp_sl_56524  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24699 marker 24699
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)