Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_56903

SGN-M24723

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73678)
Chromosome
8
Position
20.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69423)
Chromosome
8
Position
4.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65763)
Chromosome
8
Position
8.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61054)
Chromosome
8
Position
2.83 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCATACGCTTCACGAAAATCATGCTATTGTGAAGACATCACACAATTTTG
  
3' flanking region
AAAACCGAGTACCCTTTGGTACATTATGCACGCATGTTTGGGTTGACCAG
SNP nucleotide
TC
SNPdb format
GCATACGCTTCACGAAAATCATGCTATTGTGAAGACATCACACAATTTTG[T/C]
AAAACCGAGTACCCTTTGGTACATTATGCACGCATGTTTGGGTTGACCAG
  
Genomic location of solcap_snp_sl_56903  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24723 marker 24723
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)