SGN Marker solcap_snp_sl_57

SGN-M24747

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69435)
Chromosome
5
Position
61.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65774)
Chromosome
5
Position
71.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61078)
Chromosome
5
Position
60.34 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAAAATGTTTGTGGGTTTTGAATAAAGATTCAGTTTTGACAACAAGGTC
  
3' flanking region
TGTTCTTCTTCTTTTAGGATTTCAGCATCAGTGGCTACAACCCAGAAACC
SNP nucleotide
TG
SNPdb format
GTAAAATGTTTGTGGGTTTTGAATAAAGATTCAGTTTTGACAACAAGGTC[T/G]
TGTTCTTCTTCTTTTAGGATTTCAGCATCAGTGGCTACAACCCAGAAACC
  
Genomic location of solcap_snp_sl_57  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24747 marker 24747
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)