SGN Marker solcap_snp_sl_57155

SGN-M24754

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69439)
Chromosome
6
Position
74.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61085)
Chromosome
6
Position
43.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGTTAGCTTGTTTGTTTCTCTTTCTGTTCATACTATTTTCTTTGACAA
  
3' flanking region
GAAGAAAAACAAAGCAAAAAAACTCCTTCCAAGTCCAAGAAAATTGCCTA
SNP nucleotide
AC
SNPdb format
GATGTTAGCTTGTTTGTTTCTCTTTCTGTTCATACTATTTTCTTTGACAA[A/C]
GAAGAAAAACAAAGCAAAAAAACTCCTTCCAAGTCCAAGAAAATTGCCTA
  
Genomic location of solcap_snp_sl_57155  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24754 marker 24754
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)