SGN Marker TG507

SGN-M248

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATATCACTGCTAACTTTAGCTCAGCTGTTTCCAACAAAAATTAAACCTATAAAACAATTACGGTTAGAGAAAAGCTAGAGTCACATTTAC
ATTACTCTCCTTACTCCTTTTATGCAATTTTGCCTTTAATTTGCAAATTCAAGTGGGTTCTTTTATTTTTTGCTGCTCGATATACCTATA
GGTGGGAACAATATTGATTTATACATACTCTTTTTAGCGTTTGCCATTTTACTTTGCCTTTATTGCTCGTTGTGTGTTTATCTTGTATCC
TTTTTGGAGCAACCATGGCCAAAGTGTGAATTTTTATTTACATCTTGATAATCGCTGCTTTCTTGGTGGCAGCTTGGAGTGACTGTGAAT
GCTACAAATCGTGTGTTGCTCCAGTCAAGTAAACCTTCTCTGCATACAAATGTGGACTGCACAGCACTTGTGGCTGCGATTGTTT
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGCTGTGATCATTACAGCAGAGAAACCTTGGTCATCTTGGCTATCCAGATCAATCTCTCCTCGTCCAAC
CAGCGCCTTCAGGGACAAAAGGTCCCTGGATCGAGCCACAAACAGTAATGGTGAAAAGACAGATGCGTTGCTTGACTTGGGAACCTTTCC
GCTCTGGATGACTTCCAGAACAGCACCCTGAAAACTGAGTTTCCATCGATTGGACACAGCAATGGAGATTGCAGATTCACCAGCTACATT
AACCAAACCAAAATCAGCACCTGCTCTAGTCAATACTTTGAGGCATTCTTCCCTCTTGAATCTTGCAGAGATCATTAAAGCTGTATCTCC
TGTGTCCGTTCTTGCATCCAGATCACAGCCAAATTCAATCAAACATTTAAGAACGCTTGAGAACCCAAGTCGGGCTGCCATGTGTATAGG
ACGAAACTCAATGTTCCGGGTGGTTATAACTGGAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1702601.4e-53105 (23.6% of RFLP seq)+
SGN-U1702602.5e-1846 (9.5% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53345)
Chromosome
2
Position
91.45 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8726)
Chromosome
2
Position
122.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG507 was used as an overgo probe on plate 16 [well G9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P044M22,   P025I09,   P076B16,   P326H02,   P293E01

 Overgo Sequences

A sequence
TCGCTGCTTTCTTGGTGGCAGCTT
B sequence
CATTCACAGTCACTCCAAGCTGCC
AB sequence
TCGCTGCTTTCTTGGTGGCAGCTTGGAGTG
Marker sequence
ATATCACTGCTAACTTTAGCTCAGCTGTTTCCAACAAAAATTAAACCTAT
AAAACAATTACGGTTAGAGAAAAGCTAGAGTCACATTTACATTACTCTCC
TTACTCCTTTTATGCAATTTTGCCTTTAATTTGCAAATTCAAGTGGGTTC
TTTTATTTTTTGCTGCTCGATATACCTATAGGTGGGAACAATATTGATTT
ATACATACTCTTTTTAGCGTTTGCCATTTTACTTTGCCTTTATTGCTCGT
TGTGTGTTTATCTTGTATCCTTTTTGGAGCAACCATGGCCAAAGTGTGAA
TTTTTATTTACATCTTGATAATCGCTGCTTTCTTGGTGGCAGCTTGGAGT
GACTGTGAATGCTACAAATCGTGTGTTGCTCCAGTCAAGTAAACCTTCTC
TGCATACAAATGTGGACTGCACAGCACTTGTGGCTGCGATTGTTT
Genomic location of TG507  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D248 marker 248
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)