SGN Marker solcap_snp_sl_57946

SGN-M24824

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73737)
Chromosome
9
Position
0.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61155)
Chromosome
9
Position
1.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTAGCGTGTACTACAATCCGGATCATGCTTACATGAGCAAACAAATTGC
  
3' flanking region
AAATACTGTTATCTTTTGATTGGAGTTTCATCAGCTGCACTCATTTTCAA
SNP nucleotide
AG
SNPdb format
CTTAGCGTGTACTACAATCCGGATCATGCTTACATGAGCAAACAAATTGC[A/G]
AAATACTGTTATCTTTTGATTGGAGTTTCATCAGCTGCACTCATTTTCAA
  
Genomic location of solcap_snp_sl_57946  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24824 marker 24824
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)