SGN Marker solcap_snp_sl_5800

SGN-M24833

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69468)
Chromosome
12
Position
51.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61164)
Chromosome
12
Position
43.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGAGAAAAAATGTGACTACCAGGAAATAAATTAAATATGGGATGGCAGG
  
3' flanking region
TGGCTAATTTGGTGGCATGCCTCTCTTGTATCTAAATTTATTTCTCTCTT
SNP nucleotide
AT
SNPdb format
CTGAGAAAAAATGTGACTACCAGGAAATAAATTAAATATGGGATGGCAGG[A/T]
TGGCTAATTTGGTGGCATGCCTCTCTTGTATCTAAATTTATTTCTCTCTT
  
Genomic location of solcap_snp_sl_5800  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24833 marker 24833
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)