SGN Marker solcap_snp_sl_5840

SGN-M24865

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73757)
Chromosome
7
Position
42.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69482)
Chromosome
7
Position
42.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61196)
Chromosome
7
Position
57.42 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGCCACAATATATGCAAATCAAGGACTCGAGCCCTCTGAGAAGCCTACC
  
3' flanking region
TGGCAGTGCTTACAGCGGAGATAGGGTGGAGAAGGATCGAAGGCGGCGAC
SNP nucleotide
AT
SNPdb format
TGGCCACAATATATGCAAATCAAGGACTCGAGCCCTCTGAGAAGCCTACC[A/T]
TGGCAGTGCTTACAGCGGAGATAGGGTGGAGAAGGATCGAAGGCGGCGAC
  
Genomic location of solcap_snp_sl_5840  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24865 marker 24865
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)