SGN Marker solcap_snp_sl_58447

SGN-M24867

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73759)
Chromosome
2
Position
77.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69484)
Chromosome
2
Position
105.77 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65821)
Chromosome
2
Position
154.56 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61198)
Chromosome
2
Position
48.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTTTGTTTCTTTTGATTCAATTTCAGTTTCTTCTTTTCTCCTTTTCACA
  
3' flanking region
AAGCAAAAAGACAGAGAACAGCTGCAATCAAGATCAATGTTCCAACTACA
SNP nucleotide
AG
SNPdb format
ATTTTGTTTCTTTTGATTCAATTTCAGTTTCTTCTTTTCTCCTTTTCACA[A/G]
AAGCAAAAAGACAGAGAACAGCTGCAATCAAGATCAATGTTCCAACTACA
  
Genomic location of solcap_snp_sl_58447  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24867 marker 24867
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)