SGN Marker TG361

SGN-M249

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG361 image not available
Forward sequence
ATAGGGAGACAGCCTGCATGCCTGAAGAATCTAGATGCAGTGATCGAGGAAAGAGAGCGGGCGATGAGCCCAAGGTATGAGCCAAATAGA
TGTATTTAATCAAAGTTCCAATAAGTAATGCAGAGAATCAGAGCACAATGAGGACATCAAAACCATCAATTTAAGTTCAACAACAAAGCC
AGACTAACCTCCCCATTCATACGAATAAGCACATCACCAGGCTCCAAATGATTGTGAGCTGGGCCACCAGGTACCTGCAACAACAACAGA
GAGAAAATTAAGTTTTGATACATAGAACTATAGTATACTGTGTCAGGACACTTGAAAGAAGTGCACTTACCACAGAATCAACGACAAGCA
TTCCAGTCTCACTGGGTGGAGAGGAATTGCGCACCAACTATTCAAGGAAAACTTCAAAAGATTATGTATCATTATATTAGTAATAAAGCT
TGTAAACAATAAATTTTGGTGCTTACCTGCTCTGTGGCACTAAGGAGGCCAAGCCGGCGAGTTTCATCATATCCTTTGTGGAGAAAAGTT
ACCTATATGAAAAACATA
Reverse sequence
TATAGGGAGACAAGCCTGCATGCCTGCAGAATCTAGATGCAGTGATAGAGGAAAGAGAGCGGGCGATGAGCCCAAGGTATGAGCCAAATA
GATGTATTTAATCAAAGTTCCAATAAGTAATGCAGAGAATCAGAGCACAATGAGGACATCAAAACCATCAATTTAAGTTCAACAACAAAG
CCAGACTAACCTCCCCATTCATACGAATAAGCACATCACCAGGCTCCAAATGATTGTGAGCTGGGCCACCAGGTACCTGCAACAACAACA
GAGAGAAAATTAAGTTTTGATACATAGAACTATAGTATACTGTGTCAGGACACTTGAAAGAAGTGCACTTACCACAGAATCAACGACAAG
CATTCCAGTCTCACTGGGTGGAGAGGAATTGCGCACCAACTATTCAAGTAAAACTTCAAAAGATTATGTATCATTATATTAGTAATAAAG
CTTGTAAACAATAAATTTTGGTGCTTACCTGCTCTGTGGCACTAAGGAGGCCAAGCCGGCGAGTTTCATCATATCCTTTGTGGAGAAAAG
TTACCTATATGAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1450922.5e-0646 (8.2% of RFLP seq)+
SGN-U1450926.4e-0763 (11.3% of RFLP seq)+
SGN-U1450932.7e-1264 (11.5% of RFLP seq)+
SGN-U1450935.5e-3269 (12.4% of RFLP seq)+
SGN-U1450922.5e-0646 (8.3% of RFLP seq)-
SGN-U1450926.4e-0763 (11.3% of RFLP seq)-
SGN-U1450932.7e-1264 (11.5% of RFLP seq)-
SGN-U1450935.5e-3269 (12.4% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8727)
Chromosome
2
Position
105.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG361 was used as an overgo probe on plate 6 [well D5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAACGACAAGCATTCCAGTCTCAC
B sequence
AATTCCTCTCCACCCAGTGAGACT
AB sequence
CAACGACAAGCATTCCAGTCTCACTGGGTG
Marker sequence
ATAGGGAGACAGCCTGCATGCCTGAAGAATCTAGATGCAGTGATCGAGGA
AAGAGAGCGGGCGATGAGCCCAAGGTATGAGCCAAATAGATGTATTTAAT
CAAAGTTCCAATAAGTAATGCAGAGAATCAGAGCACAATGAGGACATCAA
AACCATCAATTTAAGTTCAACAACAAAGCCAGACTAACCTCCCCATTCAT
ACGAATAAGCACATCACCAGGCTCCAAATGATTGTGAGCTGGGCCACCAG
GTACCTGCAACAACAACAGAGAGAAAATTAAGTTTTGATACATAGAACTA
TAGTATACTGTGTCAGGACACTTGAAAGAAGTGCACTTACCACAGAATCA
ACGACAAGCATTCCAGTCTCACTGGGTGGAGAGGAATTGCGCACCAACTA
TTCAAGGAAAACTTCAAAAGATTATGTATCATTATATTAGTAATAAAGCT
TGTAAACAATAAATTTTGGTGCTTACCTGCTCTGTGGCACTAAGGAGGCC
AAGCCGGCGAGTTTCATCATATCCTTTGTGGAGAAAAGTTACCTATATGA
AAAACATA
Genomic location of TG361  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D249 marker 249
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)