SGN Marker solcap_snp_sl_58884

SGN-M24912

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73799)
Chromosome
12
Position
35.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69508)
Chromosome
12
Position
46.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65846)
Chromosome
12
Position
49.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61243)
Chromosome
12
Position
5.07 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTAGGACCAAATCCACAGTCTGATTCTTGATAGCATCAAAAACTTCTTG
  
3' flanking region
GGGGACTTCTTTAAGTCCCCCACCAGTTTCTTGAAAGTTTCTTCAATATC
SNP nucleotide
AG
SNPdb format
GTTAGGACCAAATCCACAGTCTGATTCTTGATAGCATCAAAAACTTCTTG[A/G]
GGGGACTTCTTTAAGTCCCCCACCAGTTTCTTGAAAGTTTCTTCAATATC
  
Genomic location of solcap_snp_sl_58884  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24912 marker 24912
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)