SGN Marker solcap_snp_sl_59581

SGN-M24994

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61325)
Chromosome
2
Position
32.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAAAAAAATCTAGAGCTCCTCCACTGGTTGGTTCAGAAGAAGATACCAA
  
3' flanking region
TTGTTTTATCCTGTTTTTTTTGGGGATTCAAAGGCAGGGAAGAGCAAGAA
SNP nucleotide
AG
SNPdb format
AAAAAAAAATCTAGAGCTCCTCCACTGGTTGGTTCAGAAGAAGATACCAA[A/G]
TTGTTTTATCCTGTTTTTTTTGGGGATTCAAAGGCAGGGAAGAGCAAGAA
  
Genomic location of solcap_snp_sl_59581  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D24994 marker 24994
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)