SGN Marker solcap_snp_sl_60559

SGN-M25102

Synonyms  
CL016197-0363
CL016197-0363_solcap_snp_sl_60559
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61433)
Chromosome
1
Position
0.34 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTTTCTAAGTGATTGTGGAGGAAAAAGATACCCTTTGTTGCAACATCCA
  
3' flanking region
TTGCGCCAGATGGACCAGTTCTTTTTTTGCCATTTTTGAAGGGATGCAAG
SNP nucleotide
AG
SNPdb format
TGTTTCTAAGTGATTGTGGAGGAAAAAGATACCCTTTGTTGCAACATCCA[A/G]
TTGCGCCAGATGGACCAGTTCTTTTTTTGCCATTTTTGAAGGGATGCAAG
  
Genomic location of solcap_snp_sl_60559  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25102 marker 25102
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)