SGN Marker solcap_snp_sl_6063

SGN-M25106

Synonyms  
SGN-U314329_C2_At5g04590_snp218
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73925)
Chromosome
11
Position
53.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69600)
Chromosome
11
Position
56.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65935)
Chromosome
11
Position
66.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61437)
Chromosome
11
Position
48.23 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGAACTTCTCAATCCCCCATGAACTGAGTAAATATTTCAATCTGCTATA
  
3' flanking region
CTGCGATCATCTCTTCTCCCATTCTCTCTCTGAGTAACAACAATAGCTTT
SNP nucleotide
TC
SNPdb format
CGGAACTTCTCAATCCCCCATGAACTGAGTAAATATTTCAATCTGCTATA[T/C]
CTGCGATCATCTCTTCTCCCATTCTCTCTCTGAGTAACAACAATAGCTTT
  
Genomic location of solcap_snp_sl_6063  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25106 marker 25106
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)