SGN Marker solcap_snp_sl_6064

SGN-M25108

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73927)
Chromosome
11
Position
53.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69601)
Chromosome
11
Position
56.31 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65936)
Chromosome
11
Position
66.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61439)
Chromosome
11
Position
48.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AACTTTCTTGGCAAGAACTGAGTTCCATAAATGGGTTCAGGTGAGTCAGG
  
3' flanking region
AAGTTCGTTCCATGGGAGTTATCATTCCGAGCTTTCACAACTTCAGGAGG
SNP nucleotide
AG
SNPdb format
AACTTTCTTGGCAAGAACTGAGTTCCATAAATGGGTTCAGGTGAGTCAGG[A/G]
AAGTTCGTTCCATGGGAGTTATCATTCCGAGCTTTCACAACTTCAGGAGG
  
Genomic location of solcap_snp_sl_6064  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25108 marker 25108
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)