SGN Marker solcap_snp_sl_6073

SGN-M25120

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 73935)
Chromosome
11
Position
53.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69606)
Chromosome
11
Position
56.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 65941)
Chromosome
11
Position
66.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61451)
Chromosome
11
Position
48.06 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATAAAACGTTTAGGTAGACGTGACATAGTGGTTGCATGGCGTGGCACGGT
  
3' flanking region
ACATACCTAGAATGGATCCATGACCTACAAGACATTTTACATCCTGCTCA
SNP nucleotide
CG
SNPdb format
ATAAAACGTTTAGGTAGACGTGACATAGTGGTTGCATGGCGTGGCACGGT[C/G]
ACATACCTAGAATGGATCCATGACCTACAAGACATTTTACATCCTGCTCA
  
Genomic location of solcap_snp_sl_6073  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25120 marker 25120
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)