SGN Marker TG363

SGN-M252

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAGATGTAAAAGATCTTCATGAGATTTTACCGCTGCCGAGTTCTGACCTCTACAAATCTGTAGAAGTGCTGTATCAGAAGTTTGAGGAAG
CGAAGTTGGAAGCTCCATTTGAGTTCAAACCAGAGATTGATGTGTTTTCTCATACTGTTGATAACCTCAAACCAGAATTGGCCTTGTTAT
TAGATCCTGTGAAGGGAAATGTTGAAAATGAGTGTGAAATTGGTGATTTTTCTGTTATAGAGCAAGGCATAGAACATTCCTTGAAGGAAC
TGGAGGGAAAAGAAGACGATTTTGTGGAATCTGTTGATGATGCTGTGACAGAAACACTTGTACCTGATAGTACCTTGAAGATGCCCATTG
CAGAGGCGGCCCAGCCTGTACTATTGGCCGAGGTTCTTGACAGTGAGAATGAAGACCTTGCAGTGAGTGCCAACCATTTTGAGACAGATG
AGTCAGCAAAAGAATTAATTATGAGAGAATTGGAGTCTGCATTATACAGTCTCTCTGACTTG
Reverse sequence
CATGCCTGCAGGCACCACCAATGGACTGCATACCTGCATTATTAAACTCCCTCCACTCTTAGCATCATTGAAAATTGCAGGATTCATTGA
CCTTAAGAATCCTCCATTTTTAGTTTGTAGCAAATTTCCTAGGCCTTCTCCAAGAGGAGGCAATTGGTAAGGGTCTTCTAGAGGCATATC
AATTGGGCTTCCAAAACCACAAGAGCTTTTTGGAGGAGAACATTCAAATGACTTCTCATTCAAGCCCCATTCACGCATCAAAGCCTCTGT
CTCCAAGTCCTCCAACATGGAAGCTCTTGTTTTGTTACTTGTTTCCTCAATTGCTATCTTGGGTTTCTCCTCATACAATTGTGCAGAAGA
TGAGTAACCGAAATTCTCAGAGATGTTCCTCCATTGAGATACACTTGGAGCATCAATGGCAAATTCTTCAATGTCCATATCAAGGTTAAA
CAAAGAACACCCACCAGCTAGAATGTCCTTCTCAAATTGCCTCAATAATCGTTCCTCGTGGGGAATCAGGCTCGCTCTCAGAACTTGGGC
CAAATTGACTATG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53284)
Chromosome
5
Position
20.23 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Pepper-AC99   
Map version
34 (location: 8731)
Chromosome
5
Position
45.25 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8730)
Chromosome
5
Position
42.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8732)
Chromosome
5
Position
16.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG363 was used as an overgo probe on plate 14 [well G2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGCAAGGCATAGAACATTCCTTG
B sequence
TTCCCTCCAGTTCCTTCAAGGAAT
AB sequence
GAGCAAGGCATAGAACATTCCTTGAAGGAA
Marker sequence
AAGATGTAAAAGATCTTCATGAGATTTTACCGCTGCCGAGTTCTGACCTC
TACAAATCTGTAGAAGTGCTGTATCAGAAGTTTGAGGAAGCGAAGTTGGA
AGCTCCATTTGAGTTCAAACCAGAGATTGATGTGTTTTCTCATACTGTTG
ATAACCTCAAACCAGAATTGGCCTTGTTATTAGATCCTGTGAAGGGAAAT
GTTGAAAATGAGTGTGAAATTGGTGATTTTTCTGTTATAGAGCAAGGCAT
AGAACATTCCTTGAAGGAACTGGAGGGAAAAGAAGACGATTTTGTGGAAT
CTGTTGATGATGCTGTGACAGAAACACTTGTACCTGATAGTACCTTGAAG
ATGCCCATTGCAGAGGCGGCCCAGCCTGTACTATTGGCCGAGGTTCTTGA
CAGTGAGAATGAAGACCTTGCAGTGAGTGCCAACCATTTTGAGACAGATG
AGTCAGCAAAAGAATTAATTATGAGAGAATTGGAGTCTGCATTATACAGT
CTCTCTGACTTG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG363  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D252 marker 252
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)