SGN Marker solcap_snp_sl_62495

SGN-M25299

Synonyms  
CL015346-0143
CL015346-0143_solcap_snp_sl_62495
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61630)
Chromosome
3
Position
57.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCGGCTGAGATAAAGGATTAAATCTACAAAACGAAGCGGAACTGGACGG
  
3' flanking region
TTGTGAGGCTTCTTAGGGAGTGAAATTGACGGAGAAAACGAGATTGCTGT
SNP nucleotide
CG
SNPdb format
AGCGGCTGAGATAAAGGATTAAATCTACAAAACGAAGCGGAACTGGACGG[C/G]
TTGTGAGGCTTCTTAGGGAGTGAAATTGACGGAGAAAACGAGATTGCTGT
  
Genomic location of solcap_snp_sl_62495  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25299 marker 25299
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)