SGN Marker TG436

SGN-M253

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG436 image not available
Forward sequence
GCTTGCATGCCTGCAGTGAGTATTATTTTCCTACAGGTAGTCATTATTTTCCTAACAGGTAGCTGAATTCCTTAACATGGAATCATAGGA
GACGGCTCTGAAATGATGTTCTGGTCCAAGTCCATGGGCAGTTGCTGCTGATATCGAGCCTGAAATGTATCAGCTCATACTCAATTTAAT
TATATACATTCATAAAAACGAAATGGATATTGAAAAGGGAATTTTGGTCTTCCTTCCAACATACTATGCACTTGAGCAGCAGTGGCGCTT
ATAGAAGCGTTTCTATGAAACATTTAAGGTTCATATTCTACATCGTAGTATCGACACTGAACAAGCTCTCAATTCCATGAAAATCTGCAA
GTCGCATCGGAAGGTATGCTTTCCTAACTCTCTTTTTTCAACATCCATCAGCATCTCAAAAGTTTG
Reverse sequence
AATCTTTTTTCCTATTATTATCCCAGAAAACTTGTAAAGAACGGCAAGAATCAATGACATAGCCCACCATAGGTATCGTAACAGAAGATT
CTGCAATATTTGTCGCCAAAATAACCTGGCGAAAAGTTTATGTTTCAGATAGAGGCATCAGTATTTTTTAGGCATCAACATTGTAGGGAC
GAAATGAAGTAATCATATCTGTTTTACAGAATATTGACAGCATCTACTTGCAGAAATAAAATTAGGAAACGGGGTACAGGGAAACGTTAA
GAGATGTTATAAAATTGTTCTGTCCTGCAAGAACTCAGCAGGCCAGGGGCTGTGCAGCTGTGGGGGGTTATAAGTACTTTAGTTGTTCCC
TTTTGTTGATGGTGGTGTATGGGCCACCTTGCATGCACCTCGACTAATTCTATCGGGTACAAGCTACCTCCCAAGTCCCACTAACACAGG
TACCGGGTAAATCTGTCCACCAAGGTTTGGGGTCTTGTGCAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132218)
Chromosome
6
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Eggplant-COSII   
Map version
63 (location: 42461)
Chromosome
6
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 8734)
Chromosome
6
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8733)
Chromosome
6
Position
10.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG436 was used as an overgo probe on plate 4 [well C10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P024L21,   P176N02,   P104P20,   P284O07,   P012D02,   P128J01,   P242H18,   P206P07,   P165G13

 Overgo Sequences

A sequence
GACGGCTCTGAAATGATGTTCTGG
B sequence
TGCCCATGGACTTGGACCAGAACA
AB sequence
GACGGCTCTGAAATGATGTTCTGGTCCAAG
Marker sequence
GCTTGCATGCCTGCAGTGAGTATTATTTTCCTACAGGTAGTCATTATTTT
CCTAACAGGTAGCTGAATTCCTTAACATGGAATCATAGGAGACGGCTCTG
AAATGATGTTCTGGTCCAAGTCCATGGGCAGTTGCTGCTGATATCGAGCC
TGAAATGTATCAGCTCATACTCAATTTAATTATATACATTCATAAAAACG
AAATGGATATTGAAAAGGGAATTTTGGTCTTCCTTCCAACATACTATGCA
CTTGAGCAGCAGTGGCGCTTATAGAAGCGTTTCTATGAAACATTTAAGGT
TCATATTCTACATCGTAGTATCGACACTGAACAAGCTCTCAATTCCATGA
AAATCTGCAAGTCGCATCGGAAGGTATGCTTTCCTAACTCTCTTTTTTCA
ACATCCATCAGCATCTCAAAAGTTTG
Genomic location of TG436  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D253 marker 253
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)