Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_62499

SGN-M25300

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61631)
Chromosome
3
Position
57.17 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCCCAACTAGAGGAGAGGAGGCAGTTAAGTTACAGAACTCTCAACTTCA
  
3' flanking region
TTGACTACTAGAGTGCATAGATGAGTTCTAGACTTTGGCAGGATTGTTGG
SNP nucleotide
TG
SNPdb format
ACCCCAACTAGAGGAGAGGAGGCAGTTAAGTTACAGAACTCTCAACTTCA[T/G]
TTGACTACTAGAGTGCATAGATGAGTTCTAGACTTTGGCAGGATTGTTGG
  
Genomic location of solcap_snp_sl_62499  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25300 marker 25300
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)