Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_62778

SGN-M25329

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74039)
Chromosome
11
Position
38.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69681)
Chromosome
11
Position
39.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66010)
Chromosome
11
Position
43.94 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61660)
Chromosome
11
Position
5.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCGCCTTCTGCATACCGATAATTAGGGCTGTACTCTTTCAACATGTGCTT
  
3' flanking region
ATGGTCTCACCAACTGATGGACTCAATTGACATTGAGTAAATCCAGCCAT
SNP nucleotide
TG
SNPdb format
TCGCCTTCTGCATACCGATAATTAGGGCTGTACTCTTTCAACATGTGCTT[T/G]
ATGGTCTCACCAACTGATGGACTCAATTGACATTGAGTAAATCCAGCCAT
  
Genomic location of solcap_snp_sl_62778  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25329 marker 25329
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)