SGN Marker solcap_snp_sl_63

SGN-M25360

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74056)
Chromosome
5
Position
52.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69698)
Chromosome
5
Position
61.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66028)
Chromosome
5
Position
71.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61691)
Chromosome
5
Position
60.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAAGCACGTAATGTTTTGGGCAATAGGCATATAGTTGAACTTGTATAAAT
  
3' flanking region
AGGATAGTCATTGCGATTTTATATCATAATGTGTTAGCATATGATTTACT
SNP nucleotide
CG
SNPdb format
TAAGCACGTAATGTTTTGGGCAATAGGCATATAGTTGAACTTGTATAAAT[C/G]
AGGATAGTCATTGCGATTTTATATCATAATGTGTTAGCATATGATTTACT
  
Genomic location of solcap_snp_sl_63  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25360 marker 25360
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)