SGN Marker TG364

SGN-M254

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG364 image not available
Forward sequence
CAGTCATGATCTTAGATCCTGTAGGTCCACTTCCTGTAAATGAAATCTGTCACCAAAAAATTTATAAAATCATTTTGAACATATTTTATG
TGAGATTCGATAAATAATCAAAAGGCAAAGTCGAAAAAGAAACAGGCAAACCTTGTCCACATGAGGATGAGATGCCAAAGGACCACCAGC
TTCAGGCCCCAATCCTGTTAAAATGTTAAGGGCACCAGAAGGAAGACCAATCTCTCTACAGATCTCACCCAACTCCAAACAGGTACTACA
ATTGAATGTCAGAGTCATTTAATTAAAGGAGCAAATGATGCGGATCAAGGATATAGATAATGAAGATGATATGATATAAGGACTCACATT
GATGCTAGTTCAGATGGCTTAAGTATTGCTGCACAACCAGCAGCCAGAGCAGGGGCAACTTTCCATATGGCCATTAACAATGGATAATTC
CTTCATAATTAAAAAAAAAAAGGATCATTGACTTGAAAAAGTGTGCTTGAATGTCATTCTCAT
Reverse sequence
GCATGCCTGCAGATATGGTACTTTCTTGCATAAATGAGATAAATATATTGTTCGCTTCAACTTGATGTACACAAATTTATTTTTTGTGCT
GTCTTATATTTCAGGATGACGTTGCAGGATGTTTTGAGTACTATGCAGGCCTTGCTGAAGCTTTGGATTCGAGAAGGATGACTCCGGTTA
ATCTTAATTCAGATTCATATAAAAGTTATGTTCTTAGAGAACCTCTTGGTGTTGTGGGATTGATAACTCCATGGTAGGTGCCATTTTCAG
AGTTATTACGTTTTTTCTTTAGTTTTACAAACCACAGACTGATCAGGTAGATGTTTGTGTACATATCTATATACACTGGTTGTTTTCGTG
TCATTGACAAGCTAAAAGTAAGTCGTTATACTTTATCTGACGTAGTCTGGCCGTCTGGTTAGTTCTTAAAATGTTGAAATATGGTTTGGA
AATGAACAATATTCAGTTAACTAGTTGTCTCCTAGTTCACCAATATATTTCATTGGAAAAGTTGGACCATAATCCTAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1448174e-1491 (17.7% of RFLP seq)+
SGN-U1561691.7e-1948 (9.4% of RFLP seq)+
SGN-U1448174.4e-20117 (22.8% of RFLP seq)+
SGN-U1561696.1e-4794 (18.3% of RFLP seq)+
SGN-U1561697.6e-65124 (24.2% of RFLP seq)+
SGN-U1448171e-11135 (25.6% of RFLP seq)-
SGN-U1561696.1e-81151 (28.6% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53285)
Chromosome
6
Position
54.90 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53286)
Chromosome
3
Position
71.62 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8735)
Chromosome
6
Position
56.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8737)
Chromosome
6
Position
33.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8736)
Chromosome
3
Position
39.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG364 was used as an overgo probe on plate 5 [well A3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACAGGCAAACCTTGTCCACATGAG
B sequence
CCTTTGGCATCTCATCCTCATGTG
AB sequence
ACAGGCAAACCTTGTCCACATGAGGATGAG
Marker sequence
CAGTCATGATCTTAGATCCTGTAGGTCCACTTCCTGTAAATGAAATCTGT
CACCAAAAAATTTATAAAATCATTTTGAACATATTTTATGTGAGATTCGA
TAAATAATCAAAAGGCAAAGTCGAAAAAGAAACAGGCAAACCTTGTCCAC
ATGAGGATGAGATGCCAAAGGACCACCAGCTTCAGGCCCCAATCCTGTTA
AAATGTTAAGGGCACCAGAAGGAAGACCAATCTCTCTACAGATCTCACCC
AACTCCAAACAGGTACTACAATTGAATGTCAGAGTCATTTAATTAAAGGA
GCAAATGATGCGGATCAAGGATATAGATAATGAAGATGATATGATATAAG
GACTCACATTGATGCTAGTTCAGATGGCTTAAGTATTGCTGCACAACCAG
CAGCCAGAGCAGGGGCAACTTTCCATATGGCCATTAACAATGGATAATTC
CTTCATAATTAAAAAAAAAAAGGATCATTGACTTGAAAAAGTGTGCTTGA
ATGTCATTCTCAT
Genomic location of TG364  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D254 marker 254
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)