SGN Marker solcap_snp_sl_63641

SGN-M25403

Synonyms  
SGN-U567086_snp225
SGN-U567086_snp225_solcap_snp_sl_63641
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70389)
Chromosome
9
Position
72.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66920)
Chromosome
9
Position
95.72 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63402)
Chromosome
9
Position
130.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61734)
Chromosome
9
Position
67.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATGAAAAGATTGCAACTCATTTTCAAGTTGCCGTCAGCTCAATTGCACA
  
3' flanking region
TCTCTCAGAACTCAGATTATTAATAGGTCTTATGATGAAGTTTCTATATG
SNP nucleotide
AG
SNPdb format
GATGAAAAGATTGCAACTCATTTTCAAGTTGCCGTCAGCTCAATTGCACA[A/G]
TCTCTCAGAACTCAGATTATTAATAGGTCTTATGATGAAGTTTCTATATG
  
Genomic location of solcap_snp_sl_63641  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25403 marker 25403
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)