SGN Marker solcap_snp_sl_63658

SGN-M25405

Synonyms  
SGN-U574631_snp27975
SGN-U574631_snp27975_SGN-U574631_snp51987_solcap_snp_sl_63658
SGN-U574631_snp51987
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70415)
Chromosome
9
Position
72.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61736)
Chromosome
9
Position
67.27 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCCACTGTTGGTGGATGGAGCTTTCTGGATTCTCTTATGCGGAAACTGAA
  
3' flanking region
GAGATGTCGAAATCTAAATCTTGTTTAGATTTCCTGATGAAACCTCTTTT
SNP nucleotide
AG
SNPdb format
CCCACTGTTGGTGGATGGAGCTTTCTGGATTCTCTTATGCGGAAACTGAA[A/G]
GAGATGTCGAAATCTAAATCTTGTTTAGATTTCCTGATGAAACCTCTTTT
  
Genomic location of solcap_snp_sl_63658  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25405 marker 25405
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)