SGN Marker solcap_snp_sl_63659

SGN-M25406

Synonyms  
SGN-U574631_snp28104
SGN-U574631_snp28104_SGN-U574631_snp52116_solcap_snp_sl_63659
SGN-U574631_snp52116
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70416)
Chromosome
9
Position
72.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66945)
Chromosome
9
Position
92.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61737)
Chromosome
9
Position
67.27 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTACATCCATTTTAGAGAAGGATCTGTCATCTTTATCATCCATTTTAAG
  
3' flanking region
GATGTCGCCAAGGTGCACCATGAACATGAAATTCTTCAAGATCTTCACAG
SNP nucleotide
AC
SNPdb format
CTTACATCCATTTTAGAGAAGGATCTGTCATCTTTATCATCCATTTTAAG[A/C]
GATGTCGCCAAGGTGCACCATGAACATGAAATTCTTCAAGATCTTCACAG
  
Genomic location of solcap_snp_sl_63659  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25406 marker 25406
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)