SGN Marker solcap_snp_sl_6370

SGN-M25410

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74078)
Chromosome
7
Position
47.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69714)
Chromosome
7
Position
43.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61741)
Chromosome
7
Position
58.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGATGATCTATGTAGTGATGAAACTTTCAATAGAGAAACCATTACTACAT
  
3' flanking region
TGGAATAAAAAATGGAAGCTGGGATCTACTGAATGATCGTGTGCTTGGAC
SNP nucleotide
AC
SNPdb format
TGATGATCTATGTAGTGATGAAACTTTCAATAGAGAAACCATTACTACAT[A/C]
TGGAATAAAAAATGGAAGCTGGGATCTACTGAATGATCGTGTGCTTGGAC
  
Genomic location of solcap_snp_sl_6370  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25410 marker 25410
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)