SGN Marker solcap_snp_sl_63704

SGN-M25411

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74079)
Chromosome
9
Position
72.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69715)
Chromosome
9
Position
91.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66044)
Chromosome
9
Position
133.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 61742)
Chromosome
9
Position
67.22 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TAATTTTTTGCAAGATTGGCTAGTGATATATGAGGTTTTGCACCTAACAA
  
3' flanking region
TGAAGGTTTCCAATAATTGGCCATGGTGATGGACCTGGTGGAAGTTTTTT
SNP nucleotide
CG
SNPdb format
TAATTTTTTGCAAGATTGGCTAGTGATATATGAGGTTTTGCACCTAACAA[C/G]
TGAAGGTTTCCAATAATTGGCCATGGTGATGGACCTGGTGGAAGTTTTTT
  
Genomic location of solcap_snp_sl_63704  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D25411 marker 25411
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)